ID: 1197096411_1197096416

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1197096411 1197096416
Species Human (GRCh38) Human (GRCh38)
Location X:122601585-122601607 X:122601624-122601646
Sequence CCAGCATTACCCTGATACCAATA CAAACAAAGAAAACTACAGAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!