ID: 1197099676_1197099683

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1197099676 1197099683
Species Human (GRCh38) Human (GRCh38)
Location X:122637407-122637429 X:122637455-122637477
Sequence CCCACAGTCACTGCGCTCTCCCT CATGCCATGTGGCCACTGCCAGG
Strand - +
Off-target summary No data {0: 3, 1: 8, 2: 22, 3: 70, 4: 310}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!