ID: 1197132314_1197132324 |
View in Genome Browser |
Spacer: 2 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1197132314 | 1197132324 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | X:123019698-123019720 | X:123019723-123019745 |
| Sequence | CCTGGCACCACAGGGATCCATCA | AGGGCAGCCAGAGGAGCAGGGGG |
| Strand | - | + |
| Off-target summary | {0: 35, 1: 98, 2: 99, 3: 128, 4: 333} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||