ID: 1197132314_1197132327 |
View in Genome Browser |
Spacer: 17 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1197132314 | 1197132327 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | X:123019698-123019720 | X:123019738-123019760 |
Sequence | CCTGGCACCACAGGGATCCATCA | GCAGGGGGTAAAACTCCACAGGG |
Strand | - | + |
Off-target summary | {0: 35, 1: 98, 2: 99, 3: 128, 4: 333} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |