ID: 1197132314_1197132327

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1197132314 1197132327
Species Human (GRCh38) Human (GRCh38)
Location X:123019698-123019720 X:123019738-123019760
Sequence CCTGGCACCACAGGGATCCATCA GCAGGGGGTAAAACTCCACAGGG
Strand - +
Off-target summary {0: 35, 1: 98, 2: 99, 3: 128, 4: 333} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!