ID: 1197199083_1197199089

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1197199083 1197199089
Species Human (GRCh38) Human (GRCh38)
Location X:123733154-123733176 X:123733179-123733201
Sequence CCAGCGGAAACCCGAGGCAAGGC CCAACGACGTGGAGACTCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 70} {0: 1, 1: 0, 2: 0, 3: 0, 4: 26}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!