ID: 1197386113_1197386116

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1197386113 1197386116
Species Human (GRCh38) Human (GRCh38)
Location X:125804448-125804470 X:125804489-125804511
Sequence CCATAATCCTAAGTGAACTAACA TACCACATGTTGTTACTTATAGG
Strand - +
Off-target summary {0: 6, 1: 121, 2: 614, 3: 1629, 4: 6793} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!