ID: 1197392354_1197392359 |
View in Genome Browser |
Spacer: 1 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1197392354 | 1197392359 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | X:125883385-125883407 | X:125883409-125883431 |
| Sequence | CCACTCCCTTGTGCAGCCTCAGG | CTTTGTGCCCACTCCAGCCATGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 4, 2: 17, 3: 195, 4: 711} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||