ID: 1197392356_1197392363

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1197392356 1197392363
Species Human (GRCh38) Human (GRCh38)
Location X:125883390-125883412 X:125883419-125883441
Sequence CCCTTGTGCAGCCTCAGGACTTT ACTCCAGCCATGGCTAAAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 40, 4: 239} {0: 7, 1: 110, 2: 692, 3: 1206, 4: 1580}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!