ID: 1197435290_1197435292

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1197435290 1197435292
Species Human (GRCh38) Human (GRCh38)
Location X:126420584-126420606 X:126420601-126420623
Sequence CCTTCTATCTTCAGTTTTTGAAG TTGAAGGTTTTTATCATAAAAGG
Strand - +
Off-target summary No data {0: 12, 1: 123, 2: 618, 3: 2032, 4: 10155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!