ID: 1197435290_1197435292 |
View in Genome Browser |
Spacer: -6 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1197435290 | 1197435292 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | X:126420584-126420606 | X:126420601-126420623 |
Sequence | CCTTCTATCTTCAGTTTTTGAAG | TTGAAGGTTTTTATCATAAAAGG |
Strand | - | + |
Off-target summary | No data | {0: 12, 1: 123, 2: 618, 3: 2032, 4: 10155} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |