ID: 1197755869_1197755872

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1197755869 1197755872
Species Human (GRCh38) Human (GRCh38)
Location X:129994242-129994264 X:129994284-129994306
Sequence CCACCGCAGTGTAGGCTATGGGT CAAGGCATTACTTGATTAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 52} {0: 1, 1: 0, 2: 0, 3: 8, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!