ID: 1197995349_1197995354

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1197995349 1197995354
Species Human (GRCh38) Human (GRCh38)
Location X:132366877-132366899 X:132366914-132366936
Sequence CCATCCTCATGCTGCTAATAAAG GGGTAATTTATAAAAGAAAGAGG
Strand - +
Off-target summary No data {0: 235, 1: 3991, 2: 10443, 3: 10552, 4: 7015}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!