ID: 1197995349_1197995355

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1197995349 1197995355
Species Human (GRCh38) Human (GRCh38)
Location X:132366877-132366899 X:132366922-132366944
Sequence CCATCCTCATGCTGCTAATAAAG TATAAAAGAAAGAGGTTTAAAGG
Strand - +
Off-target summary No data {0: 87, 1: 1624, 2: 2286, 3: 1833, 4: 1922}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!