ID: 1198231236_1198231239

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1198231236 1198231239
Species Human (GRCh38) Human (GRCh38)
Location X:134691637-134691659 X:134691652-134691674
Sequence CCTTAGGACGGCCCTTCTGGAAA TCTGGAAATGTAAACACACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 70} {0: 1, 1: 0, 2: 0, 3: 18, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!