ID: 1198343797_1198343801

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1198343797 1198343801
Species Human (GRCh38) Human (GRCh38)
Location X:135740486-135740508 X:135740519-135740541
Sequence CCCAAGGTGGAGTGCAGTGGCAC GATGGCAACTTCTGCCTCCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!