ID: 1198397457_1198397459

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1198397457 1198397459
Species Human (GRCh38) Human (GRCh38)
Location X:136234742-136234764 X:136234775-136234797
Sequence CCAGGGCTGGATAATGAAGCAGC CTGGCTAATGACGCTTTTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 147} {0: 1, 1: 0, 2: 0, 3: 5, 4: 58}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!