ID: 1198556622_1198556630

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1198556622 1198556630
Species Human (GRCh38) Human (GRCh38)
Location X:137799998-137800020 X:137800036-137800058
Sequence CCCACTAGGTGCCAGCAATACCC CATTGCAAAATGTCCTCTGCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!