ID: 1198781502_1198781504

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1198781502 1198781504
Species Human (GRCh38) Human (GRCh38)
Location X:140241857-140241879 X:140241895-140241917
Sequence CCAACTGTAATTGTGTTGGGACC TAATATTTGCTTTATGTATCTGG
Strand - +
Off-target summary No data {0: 36, 1: 428, 2: 766, 3: 825, 4: 1581}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!