ID: 1199094752_1199094763

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1199094752 1199094763
Species Human (GRCh38) Human (GRCh38)
Location X:143726134-143726156 X:143726171-143726193
Sequence CCAAGTCCCCACCTGACTCAGGA ACCTAGTGGATCCCACGCTAGGG
Strand - +
Off-target summary {0: 44, 1: 349, 2: 1240, 3: 1151, 4: 951} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!