ID: 1199094757_1199094763

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1199094757 1199094763
Species Human (GRCh38) Human (GRCh38)
Location X:143726145-143726167 X:143726171-143726193
Sequence CCTGACTCAGGAGCCCCGCTGGC ACCTAGTGGATCCCACGCTAGGG
Strand - +
Off-target summary {0: 12, 1: 1027, 2: 555, 3: 325, 4: 424} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!