ID: 1199110542_1199110552

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1199110542 1199110552
Species Human (GRCh38) Human (GRCh38)
Location X:143928811-143928833 X:143928842-143928864
Sequence CCTGTAGTCCCAGCTACCCGGGA CAGGAGAATGGTGTGGAACCCGG
Strand - +
Off-target summary {0: 648, 1: 59350, 2: 182744, 3: 269437, 4: 191041} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!