ID: 1199231578_1199231585

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1199231578 1199231585
Species Human (GRCh38) Human (GRCh38)
Location X:145442642-145442664 X:145442675-145442697
Sequence CCCCAAAATATATACCCATCTGA TGACAGTGATGGAGTCCAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 347} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!