ID: 1199231581_1199231585

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1199231581 1199231585
Species Human (GRCh38) Human (GRCh38)
Location X:145442656-145442678 X:145442675-145442697
Sequence CCCATCTGATTTTCAATAATGAC TGACAGTGATGGAGTCCAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 229} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!