ID: 1199239603_1199239606

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1199239603 1199239606
Species Human (GRCh38) Human (GRCh38)
Location X:145530709-145530731 X:145530725-145530747
Sequence CCCTGGTAAAGAATTAATATGCG ATATGCGGAGTCCTGTAGAGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!