ID: 1199420390_1199420402

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1199420390 1199420402
Species Human (GRCh38) Human (GRCh38)
Location X:147637449-147637471 X:147637482-147637504
Sequence CCAGCCCATGAAAGCAGCCACGA ACCCTGCAAAGTCACAGGGGTGG
Strand - +
Off-target summary No data {0: 36, 1: 576, 2: 887, 3: 875, 4: 847}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!