ID: 1199420393_1199420405

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1199420393 1199420405
Species Human (GRCh38) Human (GRCh38)
Location X:147637453-147637475 X:147637494-147637516
Sequence CCCATGAAAGCAGCCACGAGGGG CACAGGGGTGGAACTACCCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 24, 2: 272, 3: 556, 4: 912}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!