ID: 1199420398_1199420401

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1199420398 1199420401
Species Human (GRCh38) Human (GRCh38)
Location X:147637466-147637488 X:147637479-147637501
Sequence CCACGAGGGGGGCTGTACCCTGC TGTACCCTGCAAAGTCACAGGGG
Strand - +
Off-target summary No data {0: 57, 1: 1030, 2: 1415, 3: 1354, 4: 1011}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!