ID: 1199634832_1199634848

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1199634832 1199634848
Species Human (GRCh38) Human (GRCh38)
Location X:149805294-149805316 X:149805325-149805347
Sequence CCACCCCTGCTGCCAGCCCTGGA GGGCGGACTTCTCAGGCTGTGGG
Strand - +
Off-target summary {0: 3, 1: 4, 2: 8, 3: 95, 4: 688} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!