ID: 1199655517_1199655523

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1199655517 1199655523
Species Human (GRCh38) Human (GRCh38)
Location X:149991212-149991234 X:149991248-149991270
Sequence CCAAGCTTCCTATAGTTAGGTGG GGTCTGGCCAATGAGCTGTGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!