ID: 1199771133_1199771142

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1199771133 1199771142
Species Human (GRCh38) Human (GRCh38)
Location X:150976051-150976073 X:150976095-150976117
Sequence CCGCTTTTCATTCAATATGAAAG TGGCGCTGGTGCTGCTGAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 363} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!