ID: 1199786733_1199786737

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1199786733 1199786737
Species Human (GRCh38) Human (GRCh38)
Location X:151112680-151112702 X:151112702-151112724
Sequence CCAGCTCAAGTGTCTGTGCCAGT TCGTGGGATCTCCTGCTGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 193} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!