ID: 1200053916_1200053927

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1200053916 1200053927
Species Human (GRCh38) Human (GRCh38)
Location X:153448854-153448876 X:153448869-153448891
Sequence CCCCGCCCACCTGCCCCCTGCCC CCCTGCCCCCCAAGCCCCAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 71, 4: 695}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!