ID: 1200094515_1200094528

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1200094515 1200094528
Species Human (GRCh38) Human (GRCh38)
Location X:153650877-153650899 X:153650928-153650950
Sequence CCCCAGATGTCTTGACGGGATCA AAACTACCGCCGGAGGAGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 58} {0: 1, 1: 0, 2: 0, 3: 3, 4: 37}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!