ID: 1200128762_1200128775

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1200128762 1200128775
Species Human (GRCh38) Human (GRCh38)
Location X:153830207-153830229 X:153830253-153830275
Sequence CCGCGCCCCCGCCGCAGCGCCGG TGTACTGCTCCTCCGGTTTCTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 12, 3: 132, 4: 959} {0: 1, 1: 0, 2: 0, 3: 5, 4: 71}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!