ID: 1200128766_1200128775

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1200128766 1200128775
Species Human (GRCh38) Human (GRCh38)
Location X:153830213-153830235 X:153830253-153830275
Sequence CCCCGCCGCAGCGCCGGCGGCCC TGTACTGCTCCTCCGGTTTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 29, 4: 354} {0: 1, 1: 0, 2: 0, 3: 5, 4: 71}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!