ID: 1200154898_1200154910

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1200154898 1200154910
Species Human (GRCh38) Human (GRCh38)
Location X:153970214-153970236 X:153970229-153970251
Sequence CCCAGCCCCAGCCCCAGCCCGCT AGCCCGCTGGGTAACGGTGTGGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 91, 3: 499, 4: 1805} {0: 1, 1: 0, 2: 0, 3: 4, 4: 40}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!