ID: 1200251610_1200251619

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1200251610 1200251619
Species Human (GRCh38) Human (GRCh38)
Location X:154557140-154557162 X:154557181-154557203
Sequence CCGTGACCAAGCACCACAGACTG AACGCGTGGCCTCCCGCTTCTGG
Strand - +
Off-target summary {0: 4, 1: 2, 2: 40, 3: 352, 4: 1420} {0: 4, 1: 0, 2: 0, 3: 3, 4: 40}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!