ID: 1200251615_1200251619

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1200251615 1200251619
Species Human (GRCh38) Human (GRCh38)
Location X:154557153-154557175 X:154557181-154557203
Sequence CCACAGACTGCGGGGCCGAAGCC AACGCGTGGCCTCCCGCTTCTGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 0, 3: 17, 4: 175} {0: 4, 1: 0, 2: 0, 3: 3, 4: 40}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!