ID: 1200279362_1200279368

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1200279362 1200279368
Species Human (GRCh38) Human (GRCh38)
Location X:154763256-154763278 X:154763286-154763308
Sequence CCCACCCCGCGGTGGCGTGGGAC TGTCTGTGCTGCTGCCAGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 59} {0: 1, 1: 0, 2: 3, 3: 46, 4: 495}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!