ID: 1200297285_1200297289

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1200297285 1200297289
Species Human (GRCh38) Human (GRCh38)
Location X:154933340-154933362 X:154933361-154933383
Sequence CCTCCAACTTCTGACATAGGTAT ATAAGCTATCTGGCCAAGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 123} {0: 1, 1: 0, 2: 3, 3: 6, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!