ID: 1200326114_1200326121

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1200326114 1200326121
Species Human (GRCh38) Human (GRCh38)
Location X:155241561-155241583 X:155241607-155241629
Sequence CCCATCCTCTTCAATATAAAGAC CCTTATTCAAGGCCATACAGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 8, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!