ID: 1200334630_1200334638

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1200334630 1200334638
Species Human (GRCh38) Human (GRCh38)
Location X:155336600-155336622 X:155336651-155336673
Sequence CCAGCATCTGCTTCTGGTGAGAG TCTCACATGATGAAAGTGGGAGG
Strand - +
Off-target summary {0: 32, 1: 295, 2: 685, 3: 875, 4: 892} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!