ID: 1200372771_1200372779

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1200372771 1200372779
Species Human (GRCh38) Human (GRCh38)
Location X:155744478-155744500 X:155744520-155744542
Sequence CCTAGAATCTTAAAGTGTGGTGT AAACGGGAAGGGACTTTTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 135} {0: 1, 1: 0, 2: 5, 3: 18, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!