ID: 1200440708_1200440713

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1200440708 1200440713
Species Human (GRCh38) Human (GRCh38)
Location Y:3208818-3208840 Y:3208859-3208881
Sequence CCTGAGATTATCTATACCAATTA AATTAAGCACAGAATGATTTGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 14, 4: 130} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!