ID: 1200472975_1200472977

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1200472975 1200472977
Species Human (GRCh38) Human (GRCh38)
Location Y:3608972-3608994 Y:3609004-3609026
Sequence CCATTCTACACATTAAAAGTTAA AACATGCCACTTGTTGTTCAGGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 3, 3: 42, 4: 352} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!