ID: 1200585352_1200585359

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1200585352 1200585359
Species Human (GRCh38) Human (GRCh38)
Location Y:5000614-5000636 Y:5000653-5000675
Sequence CCGGACTGGGTACCTGTACAGGG TGAGGTCCACACTTAGTGCGCGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 1, 4: 69} {0: 2, 1: 0, 2: 0, 3: 5, 4: 47}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!