ID: 1200643093_1200643104

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1200643093 1200643104
Species Human (GRCh38) Human (GRCh38)
Location Y:5746969-5746991 Y:5747019-5747041
Sequence CCAGAGGGGCAACCAGAGCTGCA GTGGCCAAAGAGTGCTTTGCTGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 1, 3: 18, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!