ID: 1200649038_1200649044

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1200649038 1200649044
Species Human (GRCh38) Human (GRCh38)
Location Y:5817909-5817931 Y:5817957-5817979
Sequence CCAGGACTTGGTTCTTCCCTTCA GTGTGTTTCTAGAAATGTCCAGG
Strand - +
Off-target summary {0: 5, 1: 35, 2: 214, 3: 455, 4: 822} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!