ID: 1200695909_1200695913

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1200695909 1200695913
Species Human (GRCh38) Human (GRCh38)
Location Y:6359371-6359393 Y:6359389-6359411
Sequence CCTGGTGCCATGGCTAGCATAAC ATAACTCAAATAGTGGAGGTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!