ID: 1200732571_1200732574

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1200732571 1200732574
Species Human (GRCh38) Human (GRCh38)
Location Y:6758412-6758434 Y:6758449-6758471
Sequence CCTGGCTGCTTTGTTTACACTGT TACTCAAGCCTCAGCAATGATGG
Strand - +
Off-target summary {0: 12, 1: 198, 2: 559, 3: 614, 4: 1633} {0: 29, 1: 1106, 2: 1356, 3: 919, 4: 937}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!