ID: 1200926352_1200926360

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1200926352 1200926360
Species Human (GRCh38) Human (GRCh38)
Location Y:8658412-8658434 Y:8658446-8658468
Sequence CCTCTTCCCAAATACCTAGCCAC CCTCTTTCCTTAGCTTAGTCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!